Why is DNA structure an evidence of evolution?
1. Why is DNA structure an evidence of evolution?
Answer:
DNA and the genetic code reflect the shared ancestry of life. DNA comparisons can show how related species are. Biogeography. The global distribution of organisms and the unique features of island species reflect evolution and geological change.
Question ⤵️Why is DNA structure an evidence of evolution?
Answer⤵️DNA and the genetic code reflect the shared ancestry of life. DNA comparisons can show how related species are. Biogeography. The global distribution of organisms and the unique features of island species reflect evolution and geological change.
Type of evolution
• divergent
• convergent
• parallel evolution.
#CARRYONLEARNING2. state the pairing rule in DNA
The rules of base pairing (or nucleotide pairing) are:
A with T: the purine adenine (A) always pairs with the pyrimidine thymine (T)
C with G: the pyrimidine cytosine (C) always pairs with the purine guanine (G)
This is consistent with there not being enough space (20 Å) for two purines to fit within the helix and too much space for two pyrimidines to get close enough to each other to form hydrogen bonds between them.
But why not A with C and G with T?
The answer: only with A & T and with C & G are there opportunities to establish hydrogen bonds (shown here as dotted lines) between them (two between A & T; three between C & G). These relationships are often called the rules of Watson-Crick base pairing, named after the two scientists who discovered their structural basis.
The rules of base pairing tell us that if we can "read" the sequence of nucleotides on one strand of DNA, we can immediately deduce the complementary sequence on the other strand.
The rules of base pairing explain the phenomenon that whatever the amount of adenine (A) in the DNA of an organism, the amount of thymine (T) is the same (called Chargaff's rule). Similarly, whatever the amount of guanine (G), the amount of cytosine (C) is the same.
The C+G:A+T ratio varies from organism to organism (particularly among the bacteria), but within the limits of experimental error, A = T and C = G
Relative Proportions (%) of Bases in DNA
Organism A T G C
Human 30.9 29.4 19.9 19.8
Chicken 28.8 29.2 20.5 21.5
Grasshopper 29.3 29.3 20.5 20.7
Sea Urchin 32.8 32.1 17.7 17.3
Wheat 27.3 27.1 22.7 22.8
Yeast 31.3 32.9 18.7 17.1
E. coli 24.7 23.6 26.0 25.7
3. About 96% of the information in human DNA is found in gorilla DNA. This evidence supports which statement?
False factfidmdmenekenelel45n
4. which three scientists directly contributed evidence for the discovery of the role of DNA? explain
The main persons who discovered the DNA or also known as the Deoxyribonucleic acid that can be found in our blood are James Watsonand Francis Crick.The two other persons who contributed to the discovery of the DNA (Deoxyribonucleic Acid) are Rosalind Franklin and Maurice Wilkins.
Contrary to the popular belief, it's not only the Crick and Watson duo who actually made contributions to the discovery of the DNA structure. The scientists who directly contributed evidence to the discovery of the DNA are the following:
Rosalind Franklin - She was a crystal radiographer who worked on DNA crystallography. She was the one actually produced the photograph 51; the photo that was regarded as the last evidence needed by Crick and Watson to complete their model.
Maurice Wilkins - Formor colleague of Franklin who, without Franklin's knowledge, have given access to Crick and Watson to look into Franklin's study about the DNA structure. He shared the Nobel Prize with Watson and Crick for the discovery of the DNA structure.
Francis Crick and James Watson - These two scientists are the famous duo who were awarded the Nobel Prize for the discovery of the structure of the DNA. They were already working on their model of the DNA structure while Franklin was doing her own crystallography research on it. Franklin's photograph greatly helped them to finalize and confirm the structure of the DNA.
More info about the DNA can be found in these links.
https://brainly.ph/question/242
https://brainly.ph/question/466855
https://brainly.ph/question/471547
5. What area of science does NOT have evidence for evolution?A. AstronomyC. Comparative anatomyB. DNA evidenceD. Fossil record
Answer:
D. Fossil record#CarryOnLearningAnswer:
d. fossil record
Explanation:
that what I searched
6. 3. Evidence of evolution includesa. DNA sequence analysisb. fossil recordsc. anatomical evidenced. all of the above
[tex] \blue{ \overbrace{ \overbrace{ \underline{ \underbrace{ \underline { \underbrace{ \underline{ \boxed{ \boxed{ \boxed{answer}}}}}}}}}}}[/tex]
[tex] \huge\red{ \overbrace{ \overbrace { \underbrace{ \underline { \underbrace{ \underline{ \boxed{ \boxed{ \boxed \tt{a.}}}}}}}}}}[/tex]
[tex] \pink{ \overbrace{ \overbrace { \underbrace{ \underline { \underbrace{ \underline{ \boxed{ \boxed{ \boxed \{carryonlearning}}}}}}}}}[/tex]
7. Why nuclear DNA is considered as individual evidence?
Answer:
it unique
Explanation:
no one has the similar identity of an individual
8. explain how this DNA sequence can be evidence of evolution
Answer:
it is the genetic coding of traits
9. The main rule for base pairing in dnapa sagot plss ng tama
Answer:
Base-pairing rule – the rule stating that in dna, cytosine pairs with guanine and adenine pairs with thymine add in rna, adenine pairs with uracil
Explanation:
paki brainliest po pls
10. what are the base pairing rules for dna
Chargaff's rules state that DNA from any species of any organism should have a 1:1 protein stoichiometry ratio of purine and pyrimidine bases and, more specifically, that the amount of guanine should be equal to cytosine and the amount of adenine should be equal to thymine.
Sana naka tulong
11. try to recall your knowledge and rules about dna replication now it's your time to draw the correct shape and code for the other strand of dna
Answer:
elucidation of the structure of the double helix provided a hint as to how DNA is copied. Recall that adenine nucleotides pair with thymine nucleotides, and cytosine with guanine. This means that the two strands are complementary to each other.
12. What is the most commonly used biological evidence used for DNA testing? Why?
Answer:
One of the most reliable forms of evidence in many criminal cases is in our genes, encoded in DNA (deoxyribonucleic acid). DNA evidence can be collected from blood, hair, skin cells, and other bodily substances. It can even be used to solve old crimes that occurred prior to the development of DNA-testing technology
Explanation:
13. DNA as evolutionary evidence is moderntrue or false?
Answer:
True because it can help people understand how it does evolve.
14. Explain how DNA/protein sequences can provide evidence of evolution
Answer:
DNA and the genetic code reflect the shared ancestry of life. DNA comparisons can show how related species are. Biogeography. The global distribution of organisms and the unique features of island species reflect evolution and geological change.Explanation:
#CARRYONLEARNING15. What is the difference in the base pairing rules for DNA and RNA?
Answer:
The four bases that make up this code are adenine (A), thymine (T), guanine (G) and cytosine (C). Bases pair off together in a double helix structure, these pairs being A and T, and C and G. RNA doesn't contain thymine bases, replacing them with uracil bases (U), which pair to adenine1.
Explanation:
PA BRAINLIEST PO
16. Give two instances where you can use DNA as evidence
adopted
real parents
EXPLANATI
if you want to know your adopted
if you want to know if your parents are youre real parents
17. What evidence is it, where organisms have the most DNA sequences in common.
Answer:
The evidence that organisms have the most DNA sequences in common comes from the field of molecular biology and genetics. Scientists have conducted extensive studies on the DNA sequences of various organisms and have found that all living things share a significant amount of DNA.
One of the most compelling pieces of evidence for this is the fact that the genetic code, which determines the sequence of amino acids in proteins, is universal across all living things. This means that the same DNA code is used to create proteins in all organisms, from bacteria to humans.
Furthermore, studies of DNA sequences have shown that organisms that are more closely related in evolutionary terms have more similar DNA sequences. For example, humans and chimpanzees share about 98% of their DNA, while humans and bacteria share far less.
Finally, scientists have also used DNA sequence comparisons to construct phylogenetic trees, which show the evolutionary relationships between different organisms. These trees are based on the idea that the more similar the DNA sequences between two organisms, the more closely related they are.
Overall, the evidence for common DNA sequences among living things is strong and has been extensively studied and documented by molecular biologists and geneticists.
18. 24. Is a change in the base sequence of DNA?a. mutation b.gene mutation c. diromosomal mutation d. deletron25. It is used to identify persons responsible for crimes and provide evidence for identity of dead persa. DNA b. RNA c. DNA fingerprintingd. DNA technology
Answer:
yes is yes is yes is yesyeys
19. 3. DNA evidence suggests that the closest relative to the human is the:
Answer:
chimpanzees
it confirms that our closest living biological relative are chimpanzees and bonobos,
Explanation:
hope it helps
pls like and follow for more answers
20. It is possible to get DNA evidence from a shaft of a hair? True or false?
True becauseYou’ve personally selected to take part in our 2020 Annual Visitor Survey
There are essentially three types of DNA testing. ... And a hair shaft simply doesn't contain nuclear DNA. In other words, you can only do one of the three types of DNA testing on a lock of hair that doesn't have a root or follicle attached, and that's the mtDNA testing.
In some people, traces of cell nuclei may be found in the hair itself, not only in its root, but this is quite rare. In most cases, nuclear DNA is broken down into its building blocks, and if a hair lacks a root, it will be impossible to extract a useful DNA sample.
21. Guide Questions:1.Identify how many nucleotides are there in the DNA code?2.State the base pairing rule in DNA?3.The amount of adenine in DNA is equal to the amount of?4.The number of Guanine is always equal to the number of?
1.)Each gene's code uses the four nucleotide bases of DNA: adenine (A), cytosine (C), guanine (G) and thymine (T) — in various ways to spell out three-letter “codons” that specify which amino acid is needed at each position within a protein.
2.)Under normal circumstances, the nitrogen-containing bases adenine (A) and thymine (T) pair together, and cytosine (C) and guanine (G) pair together. The binding of these base pairs forms the structure of DNA .
3.)thymine
4.)Chargaff's rules states that DNA from any cell of all organisms should have a 1:1 ratio of pyrimidine and purine bases and, more specifically, that the amount of guanine is equal to cytosine and the amount of adenine is equal to thymine.
sana po makatulong
22. Which three scientists directly contributed evidence for the discovery of the role of DNA?
Answer:
The main persons who discovered the DNA or also known as the Deoxyribonucleic acid that can be found in our blood are James Watson and Francis Crick. The two other persons who contributed to the discovery of the DNA (Deoxyribonucleic Acid) are Rosalind Franklin and Maurice Wilkins.Aug 27, 2018
23. Venerdy DNA Strand using DNA base pairing rules.(5 Points) hd ( A T G G T) A G T A A T T
Answer:
Need points Po sorry
Explanation:
Bawi next time
24. it is the set of rules that specify to the condons in DNA or RNA that corresponds to the amino acids in proteins.
Answer:
The genetic code
Explanation:
is a set of three-letter combinations of nucleotides called codons, each of which corresponds with a specific amino acid or stop signal. ... The start codon in all mRNA molecules has the sequence AUG and codes for methionine.
25. Use the base pairing rules to transcribe the following DNA sequence into mRNA
Answer:
An enzyme called RNA polymerase reads the template DNA strand to produce an mRNA molecule.
Explanation:
A DNA molecule is double stranded. One strand of the molecule is the template strand and one is called the coding strand.
template:ACACGGCTTAATGTGCCGAATT
coding:The bases will always pair A with T and C with G.When the RNA polymerase transcribes the DNA it reads only the template strand. It will pair the appropriate nucleutides with their partners on the template strand of DNA using A,C,G and U (U replaces T in RNA)
template:ACACGGCTTAA
UGUGCCGAAUU
hope it helps☺️
26. When you are comparing DNA to support evolution you are using what evidence?
Answer:
Organisms that seem fairly similar on the basis of comparative anatomy, show more genes in common than organisms that aren't much alike. For example, 96% of the genes in humans and chimpanzees are identical. That two species and their common ancestor have similar DNA is strong evidence supporting evolution.
Explanation:
HOPE IT HELPS27. What are the rules of the DNA genes and proteins in a given trait
Answer:
The traits of a living thing depend onthe complex mixture of interacting components inside it. Proteins do much of the chemical work inside cells, so they largely determine what those traits are. But those proteins owe their existence to the DNA (deoxyribonucleic acid).Explanation:
HOPE IT HELPS!!28. What are the DNA base pairing rules
Answer:
Cytosine pairs with guanine and adenine pairs with thymine add in rna, adenine pairs with uracil.
Explanation:DNA and RNA bases are also held together by chemical bonds and have specific base pairing rules. In DNA/RNA base pairing, adenine (A) pairs with uracil (U), and cytosine (C) pairs with guanine (G). The conversion of DNA to mRNA occurs when an RNA polymerase makes a complementary mRNA copy of a DNA “template” sequence.#CarryOnLearning
29. which three scientists directly contributed evidence for the discovery of the role of DNA
The main persons who discovered the DNA or also known as the Deoxyribonucleic acid that can be found in our blood are James Watson and Francis Crick. The two other persons who contributed to the discovery of the DNA (Deoxyribonucleic Acid) are Rosalind Franklin and Maurice Wilkins. These are the people who discovered and contributes to the discovery of the Deoxyribonucleic acid.
More about DNA by clicking the links below:
https://brainly.ph/question/60841
https://brainly.ph/question/1255613
https://brainly.ph/question/1438336
30. The strongest direct evidence that dna is the genetic material comes from which contemporary methodology
[tex]\tt\color{cyan}{Answer}[/tex]
Recombinant DNA
The most probable evidence that Deoxyribonucleic acid or DNA is the genetic material is derived from the Recombinant DNA technology.
Recombinant DNA technology comprises altering genetic material outside an organism to obtain enhanced and desired characteristics in living organisms or as their products. This technology involves the insertion of DNA fragments from a variety of sources, having a desirable gene sequence via appropriate vector
